View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8757_low_17 (Length: 288)
Name: NF8757_low_17
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8757_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 36 - 276
Target Start/End: Original strand, 27693514 - 27693754
Alignment:
| Q |
36 |
acttacgcaagagaatgaagagaaatagagcgcgcactgctgtatcgtatatcatgctgcggtatgacaattgttcctcttcccggtcacggtctctgtc |
135 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693514 |
acttacgcaagagaatgaagaaaaatagagcgcccattgctgtatcgtatatcatgctggggtatgacaattgttcctcttcccggtcacggtctctgtc |
27693613 |
T |
|
| Q |
136 |
ttgctgatgctgttcacagcgttttggtcgccaacgaagctcaattccgttgacatactccctgtatacatctggataacgacacttgctgctattacat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27693614 |
ttgctgatgctgttcacagcgttttggtcgccaacgaagctcaattccgttgacatactccctgtatacatctggataaccacacttgctgctattacat |
27693713 |
T |
|
| Q |
236 |
ttcagctttccatcccagctactcataattaccttcatctc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693714 |
ttcagctttccatcccagctactcataattaccttcatctc |
27693754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University