View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8757_low_18 (Length: 270)
Name: NF8757_low_18
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8757_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 3302765 - 3303012
Alignment:
| Q |
18 |
aaaccaaatgccaaatagggacctcccacaaagcaaaccaaagcatatcaagaattctgatttactttcaatgtagcagcttccaccgatcaaaatctta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3302765 |
aaaccaaatgccaaatagggacctcccacaaagcaaaccaaagcatatcaagaactctgatttactttcaatgtagcagcttccactgatcaaaatctta |
3302864 |
T |
|
| Q |
118 |
ttacatcaatcccctaaagagtgaccgctatttatatacgctatcatgaaaggagaggctttgtagaaattgttcggttgattcaacataatattcagag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3302865 |
ttacatcaatcccctaaagagtgaccgctatttatatacgctatcatgaaaggagaggctttgtagaaattgttcggttgattcaacataatattcagag |
3302964 |
T |
|
| Q |
218 |
ttttgcacaaagcaattgcaaacgcaaggctttgatgtccatctcatt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
3302965 |
ttttgcacaaagcaattgcaaacgcaaggctttggtaaccatctcatt |
3303012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 3290900 - 3290958
Alignment:
| Q |
18 |
aaaccaaatgccaaatagggacctcccacaaagcaaaccaaagcatatcaagaattctg |
76 |
Q |
| |
|
||||| |||||||||| ||||||| || |||| |||||||||||||||||||| |||| |
|
|
| T |
3290900 |
aaaccgaatgccaaatggggaccttccccaaaagaaaccaaagcatatcaagaaatctg |
3290958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University