View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8757_low_19 (Length: 268)
Name: NF8757_low_19
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8757_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 22 - 252
Target Start/End: Original strand, 970975 - 971199
Alignment:
| Q |
22 |
tgaacatcatttcagatttgttgagattgatcttttggcctgatatcctttggtattcagcaaaaatctccattaagtgtttagcttcatttttatgagt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
970975 |
tgaacatcatttcagatttgttgagattgatcttttggcatgatatcctttggtattcagcaaaaatctccattaagtgtttagcttcatttttatgagt |
971074 |
T |
 |
| Q |
122 |
tctgcagaacatcatgctatcatcagcnnnnnnnngatgtgaaataacatgggcgtttctggctatagctatagagatgccgtgaattttatcttgttca |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||| ||||||| |||||| ||||||| ||| |||||||||||||| |
|
|
| T |
971075 |
tctgcagaacatcatgctatcatcagtaaaaaaaagatgtgaaataacaggggtgtttctg------gctataaagatgccatgagttttatcttgttca |
971168 |
T |
 |
| Q |
222 |
tggtacttagtgataaggccagagaggactt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
971169 |
tggtacttagtgataaggccagagaggactt |
971199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University