View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8757_low_24 (Length: 238)

Name: NF8757_low_24
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8757_low_24
NF8757_low_24
[»] chr5 (1 HSPs)
chr5 (16-238)||(8211482-8211704)


Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 8211482 - 8211704
Alignment:
16 aaaacaactcaaacaaaacataaaccctaattcaataaccccaggctcatgcatcagctcctgggacttcacctttgacccatgtgacaatctcttcagt 115  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8211482 aaaacaactcaaacaaaacataaaccgtaattcaataaccccaggctcatgcatcagctcctgggacttcacctttgacccatgtgacaatctcttcagt 8211581  T
116 gaaaaattcacctgcggattcagatgtgacacaatcatctccaatctgagtcgagtcactgaactcagtctcgaccaagctggttactcaggctcactta 215  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
8211582 gaaaaattcacctgcggattcagatgtgacaccatcatctccaatctgagtcgagtcactgaactcactctcgaccaagctggttactcaggctcactta 8211681  T
216 gcatagacaattttccttatctc 238  Q
    |||||||||||||||||||||||    
8211682 gcatagacaattttccttatctc 8211704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University