View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8757_low_26 (Length: 228)
Name: NF8757_low_26
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8757_low_26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 3 - 228
Target Start/End: Original strand, 4487192 - 4487417
Alignment:
| Q |
3 |
ggtgaaaaatgttaagcctattagcacaactatttaactgtcatttaagatgggataaattaaggttttgaactctaccatttaagttggttcgtcctac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4487192 |
ggtgaaaaatgttaagcctattagcacaactatttaactgtcatttaagatgggataaattaaggttttgaactctaccatttaagttggttcgtcctac |
4487291 |
T |
|
| Q |
103 |
ttaatccgtgtaaaaataaagtgacatggttggacaagtggtttgtaggtaatttacaaaatctctttctttttctacttgagttatttatattttctgc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4487292 |
ttaatccgtgtaaaaataaagtgacatggttggactagtggtttgtaggtaatttacaaaatctctttctttttctacttgagttatttatattttctgc |
4487391 |
T |
|
| Q |
203 |
aactattaacatattctctctttaca |
228 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4487392 |
aactattaacatattctctctttaca |
4487417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University