View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8757_low_6 (Length: 406)
Name: NF8757_low_6
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8757_low_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 51 - 406
Target Start/End: Complemental strand, 35679327 - 35678972
Alignment:
| Q |
51 |
tctttgtgtttagcaagtggagcaattatgttggatgtgtggctgggcatttttctttgctgtggtttttaattgcggtggttcatcattaagttcatgc |
150 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35679327 |
tctttgtgtttagcaagtggagcaataatgttggatgtgtggctgggcatttttctttggtgtggtttttaattgcggcggttcatcattaagttcatgc |
35679228 |
T |
|
| Q |
151 |
aattttgattgtagaggtaccaaagctagtttccaggtgattgatatataatatgctgcatagcgatccaaaacttgcataattgtgcagttcagctttt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35679227 |
aattttgattgtagaggtaccaaagctagtttgcaggtgattgatatataatatgctgcatagcgatccaaaatttgcataattgtgcagttcagctttt |
35679128 |
T |
|
| Q |
251 |
gacggatcaatcattttggtcctaaaatttgcaaatagacaataaggtctttgaaattgtatggtgtcaatcaatttggtgcttctatttagttaaatga |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35679127 |
gacggatcaatcattttggtcctaaaatttgcaaatagacaataaggtctttgaaattgtatggtgtcaatcaatttggtgcttctatttagttaaatga |
35679028 |
T |
|
| Q |
351 |
caaatggttcaatacaaaaaacgagtggcgggtattcagtaaagaaatgcatagtt |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35679027 |
caaatggttcaatacaaaaaacgagtggcgggtattcagtaaagaaatgcatagtt |
35678972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University