View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8758_high_32 (Length: 256)
Name: NF8758_high_32
Description: NF8758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8758_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 52544096 - 52544329
Alignment:
| Q |
1 |
ttagtcatttgatggatcgttcatcaatgcactttactagatgtcccgtttataggattgttgataaatgctttgtgtctatcatacagtttgtgtataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52544096 |
ttagtcatttgatggatcgttcatcaatgcactttactagatgtccc----ataggattgttgataaatgctttgtgtctatcatacagtttgtgtataa |
52544191 |
T |
 |
| Q |
101 |
attcagttggctctgattgtttatggtggtcttgacgcaattgattgcttgtagaaatacttcatcatcagttttttattttaatgctagccttttatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52544192 |
attcagttggctctgattgtttatggtggtcttgactcaattgattgcttgtagaaatacttcatcatcagtttttgattttaatgctagccttttatgc |
52544291 |
T |
 |
| Q |
201 |
tgaactaagcctatcgtgcatggtacatggttggatgt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52544292 |
tgaactaagcctatcgtgcatggtacatggttggatgt |
52544329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University