View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8758_high_33 (Length: 254)
Name: NF8758_high_33
Description: NF8758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8758_high_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 8296579 - 8296817
Alignment:
| Q |
1 |
tattagaagctcttataaaatatgaaggggcctcatggaagacaataaatttacagaaat---cagaaatannnnnnnaccaagaacacgaatcacacga |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8296579 |
tattagaagctcttataaaatatgaaggggcctcagggaagacaataaatttacataaatgatcagaaatatttttt-accaagaacacgaatcacacga |
8296677 |
T |
|
| Q |
98 |
ctagggagatggtgaagagaattttacaagtttcagagagtataggctcaggaaaatatttgggtttaccatcgagaccgtatttggaagagagaataca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8296678 |
ctagggagatggtgaagagaattttacaagtttcagagagtataggctcaggaaaatatttgggtttaccatcgagaccgcatttggaagagagaataca |
8296777 |
T |
|
| Q |
198 |
aaattggtcaggaaaacatttatccattgcaagaagagag |
237 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
8296778 |
aaattggtcatgaaaacatttatccattgcaggaagagag |
8296817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 221
Target Start/End: Complemental strand, 15162650 - 15162618
Alignment:
| Q |
189 |
gagaatacaaaattggtcaggaaaacatttatc |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
15162650 |
gagaatacaacattggtcaggaaaacatttatc |
15162618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University