View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8758_high_42 (Length: 237)
Name: NF8758_high_42
Description: NF8758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8758_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 219
Target Start/End: Original strand, 7924622 - 7924826
Alignment:
| Q |
14 |
aagaaatggaacgagtacattaacatcacgattaaatccaaaatcagtggcccacaatcttagcttctctcagtcatcgtctttgaattctctgatcaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7924622 |
aagaaatggaacgagtacattaacatcacgattaaatccaaaatcagtg-cccacaatcttagcttctctcagtcatcgtctttgaattctctgatcaaa |
7924720 |
T |
 |
| Q |
114 |
tattaaacacaaaatagtgttagcaattttcatggttattgcaaaacgtgtgccaaatgacaaaattaccatggtatacataatgactaaactaattcat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7924721 |
tattaaacacaaaatagtgttagcaattttcatggttattgcaaaacgtgtgccaaatgacaaaattaccatggtatacataatgactaaactaattcat |
7924820 |
T |
 |
| Q |
214 |
tattaa |
219 |
Q |
| |
|
|||||| |
|
|
| T |
7924821 |
tattaa |
7924826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University