View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8758_low_29 (Length: 307)
Name: NF8758_low_29
Description: NF8758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8758_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 26 - 288
Target Start/End: Original strand, 18981745 - 18982021
Alignment:
| Q |
26 |
attatactgtctcctttagtcaaatttgatttatatgaagnnnnnnnncgtcaacaactttacattgactttctttgagaaattttttagaccccttcaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18981745 |
attatactgtctcctttagtcaaatttgatttatatgaaggaaaaaaacgtcaacaactttacattgactttctttgagaaattttttagaccccttcaa |
18981844 |
T |
|
| Q |
126 |
aaaatttattgcataaactt-atttacaattatcttaatgattttacattattataggcaaaaagcaatacgaatttataatcttttcttatcttctttt |
224 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18981845 |
aaaatttattgcataaactttatttacaattatcttaatgattttacattattataggaaaaaagcaatacgaatttataatcttttcttatcttctttt |
18981944 |
T |
|
| Q |
225 |
gttggtttctaacttaaacctccac-------------tttaattagagtgttaatgtgacaaaatcaatttattat |
288 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18981945 |
gttggtttctaacttaaacctccactctaaaataaaattttaattagagtgttaaggtgacaaaatcaatttattat |
18982021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University