View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8758_low_32 (Length: 297)
Name: NF8758_low_32
Description: NF8758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8758_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 5 - 273
Target Start/End: Original strand, 50423508 - 50423778
Alignment:
| Q |
5 |
gttggtgtccccgtcaagttctggtgccttaatctgctgctgtttggtggtcaggctcgtcccagccgtgctgttattctgctgacagcgctgatgtgct |
104 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50423508 |
gttggtgtccccgtcaagttctggtgcgttaatctgctgctgtttggtggtcaggctcgtcccagccgtgctgttattctgctgacagcgctgatgtgct |
50423607 |
T |
 |
| Q |
105 |
gct--ggttgtgacagttcagcagcagcttctgctgtattgcagtgttttaggggatttgttggttgctggcctgttgtttgtaaggcttggctatggga |
202 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50423608 |
gctatggttgtgacagttcagcagcagcttctgctgtattgcaatgttttaggggatttgttggttgctggcctgttgtttataaggcttggctatggga |
50423707 |
T |
 |
| Q |
203 |
ttgaattttggtgtggatcgctagatttcaaagacatagctttcgcaatcttagattcttggggtgcttgc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50423708 |
ttgaattttggtgtggatcgctagatttcaaagacatagctttcgcaatcttagattcttggggtgcttgc |
50423778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 62 - 125
Target Start/End: Complemental strand, 4636616 - 4636553
Alignment:
| Q |
62 |
cgtcccagccgtgctgttattctgctgacagcgctgatgtgctgctggttgtgacagttcagca |
125 |
Q |
| |
|
||||||||| |||||| | |||||||| ||||||||||||||||||| || ||||||||||||| |
|
|
| T |
4636616 |
cgtcccagctgtgctggtcttctgctggcagcgctgatgtgctgctgtttttgacagttcagca |
4636553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University