View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8758_low_32 (Length: 297)

Name: NF8758_low_32
Description: NF8758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8758_low_32
NF8758_low_32
[»] chr3 (1 HSPs)
chr3 (5-273)||(50423508-50423778)
[»] chr2 (1 HSPs)
chr2 (62-125)||(4636553-4636616)


Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 5 - 273
Target Start/End: Original strand, 50423508 - 50423778
Alignment:
5 gttggtgtccccgtcaagttctggtgccttaatctgctgctgtttggtggtcaggctcgtcccagccgtgctgttattctgctgacagcgctgatgtgct 104  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50423508 gttggtgtccccgtcaagttctggtgcgttaatctgctgctgtttggtggtcaggctcgtcccagccgtgctgttattctgctgacagcgctgatgtgct 50423607  T
105 gct--ggttgtgacagttcagcagcagcttctgctgtattgcagtgttttaggggatttgttggttgctggcctgttgtttgtaaggcttggctatggga 202  Q
    |||  |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
50423608 gctatggttgtgacagttcagcagcagcttctgctgtattgcaatgttttaggggatttgttggttgctggcctgttgtttataaggcttggctatggga 50423707  T
203 ttgaattttggtgtggatcgctagatttcaaagacatagctttcgcaatcttagattcttggggtgcttgc 273  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50423708 ttgaattttggtgtggatcgctagatttcaaagacatagctttcgcaatcttagattcttggggtgcttgc 50423778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 62 - 125
Target Start/End: Complemental strand, 4636616 - 4636553
Alignment:
62 cgtcccagccgtgctgttattctgctgacagcgctgatgtgctgctggttgtgacagttcagca 125  Q
    ||||||||| |||||| | |||||||| ||||||||||||||||||| || |||||||||||||    
4636616 cgtcccagctgtgctggtcttctgctggcagcgctgatgtgctgctgtttttgacagttcagca 4636553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University