View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8758_low_39 (Length: 250)
Name: NF8758_low_39
Description: NF8758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8758_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 48678180 - 48678411
Alignment:
| Q |
1 |
atctcatctaaccaaaactccgacacaaacataacagtgatctgtataattgtaaaggacaaacaatgtgaaatgctaataatttgtttattagaactgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48678180 |
atctcatctaaccaaaactccgacacaaacataacagtaatctgtataattgtaaaggacaaacaatgtgaaatgctaataatttgtttattagaactat |
48678279 |
T |
|
| Q |
101 |
agacatatagggacaaagcatagccaccattgtttgttgacttgaaagttatgatttatatgaccaaatatcgtagttcttagtagtttaagaagctgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48678280 |
agacatatagggacaaagcatagccaccattgtttgttgacttgaaagttatgatttatatgagcaaatatcatagttcttagtagtttaagaagctgga |
48678379 |
T |
|
| Q |
201 |
aagaggagaatggatcttctaaggtgtaattt |
232 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
48678380 |
aagaggagaatagatcttctaaggtgtaattt |
48678411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University