View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8758_low_42 (Length: 242)
Name: NF8758_low_42
Description: NF8758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8758_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 29306621 - 29306496
Alignment:
| Q |
1 |
atcaaaacagcaactgtgatcgcagttgcgttgtaagcctttatattgcggcaaaatgcagacaaatatggccgatgagccacatttacgccggctggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
29306621 |
atcaaaacagcaactgtgatcgcagttgcgttgtaagcctttatattgcggcaaaatgcagacaaatatggccgatgagccacattta---cggctgcaa |
29306525 |
T |
 |
| Q |
101 |
tactaatgtgaagaactctaaatttttta |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29306524 |
tactaatgtgaagaactctaaatttttta |
29306496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University