View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8758_low_48 (Length: 230)
Name: NF8758_low_48
Description: NF8758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8758_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 33317707 - 33317485
Alignment:
| Q |
1 |
attggtcattgagactaaaaagttacagaattgttttatcaacaaagaggcttcttcttccattggtcttaaagatgagaagggaaacaatgaggacata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33317707 |
attggtcattgagactaaaaagttacagaattgttttatcaacaaagaggcttcttcttccattggtcttaaagatgagaagggaaacaatgaggacata |
33317608 |
T |
 |
| Q |
101 |
tctaagcataagtttaacaatgttacacctttttcgagattgagagattcagaggcaatggtttccatgtttgcaaagaggttaggtgccatcaaacaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33317607 |
tctaagcataagtttaacaatgttacgcctttttcgagattgagagattcagaggcaatggtttccatgtttgcaaagaggttaggtgccatcaaacaat |
33317508 |
T |
 |
| Q |
201 |
gccaacaaacagaataatctacc |
223 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
33317507 |
gccaacaaacagaatagtctacc |
33317485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 57
Target Start/End: Original strand, 347686 - 347724
Alignment:
| Q |
19 |
aaagttacagaattgttttatcaacaaagaggcttcttc |
57 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
347686 |
aaagttacataattgttttatgaacaaagaggcttcttc |
347724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University