View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8758_low_51 (Length: 212)

Name: NF8758_low_51
Description: NF8758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8758_low_51
NF8758_low_51
[»] chr5 (3 HSPs)
chr5 (24-146)||(31531799-31531921)
chr5 (135-197)||(31531941-31532003)
chr5 (61-107)||(2380346-2380392)


Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 24 - 146
Target Start/End: Original strand, 31531799 - 31531921
Alignment:
24 tgtcctcagtatacttgtggtcgagtatcttggttagggatggacaaagttcagtttagacccaaaattgtgtctgaaccaaaccgaactgaactgtttt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||    
31531799 tgtcctcagtatacttgtggtcgagtatcttggttagggatgggcaaagttcaatttagactcaaaattgtgtctgaaccgaaccgaactgaactgtttt 31531898  T
124 tcggttcgtttgaactgaaccaa 146  Q
    || ||||||||||||||||||||    
31531899 tcagttcgtttgaactgaaccaa 31531921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 135 - 197
Target Start/End: Original strand, 31531941 - 31532003
Alignment:
135 gaactgaaccaacttaatatgaatcacattaccaacatcttcttcaatttactggttctgcat 197  Q
    |||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||    
31531941 gaactgaaccaacttaatatgaatcacagtaccaacatcgtcttcaatttaatggttctgcat 31532003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 107
Target Start/End: Complemental strand, 2380392 - 2380346
Alignment:
61 ggatggacaaagttcagtttagacccaaaattgtgtctgaaccaaac 107  Q
    |||||| |||||||||||| ||| ||||||||| |||||||||||||    
2380392 ggatgggcaaagttcagttcagatccaaaattgagtctgaaccaaac 2380346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University