View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8759_low_4 (Length: 355)
Name: NF8759_low_4
Description: NF8759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8759_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 38623866 - 38623630
Alignment:
| Q |
18 |
agaagctgtttattggagcttcagtttcatcgtatgattatannnnnnngccttgatatatggtgagtggtcgttgttgactatgacagtttgactgcaa |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38623866 |
agaagctgttttttggagcttcagtttcatcgtatgattatatttttttgccttgatatatggtgagtggtcgttgttgactatgacagtttgactgcaa |
38623767 |
T |
|
| Q |
118 |
atttgggatcaatttttcttaccctatcataaataatttgttccgtttctctcttgagacggttacacccacccacagttcatatgtttatgttttcgtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38623766 |
atttgggatcaatttttcttaccctatcataaataatttgttccctttctctcttgagacggttacacccacccacagttcatatgtttatgttttcgtc |
38623667 |
T |
|
| Q |
218 |
acataaataatttattttacatttaacttccgtcaag |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38623666 |
acataaataatttattttacatttaacttccgtcaag |
38623630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 300 - 355
Target Start/End: Complemental strand, 38623584 - 38623529
Alignment:
| Q |
300 |
tccatttgcaagtaggagaaaacatccacatttgataatagaacactaggtctgtt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38623584 |
tccatttgcaagtaggagaaaacatccacatttgataatagaacaccaggtctgtt |
38623529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University