View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8759_low_6 (Length: 303)
Name: NF8759_low_6
Description: NF8759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8759_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 285
Target Start/End: Complemental strand, 7723815 - 7723545
Alignment:
| Q |
12 |
tggtggtggtggttatacatcgaagctgactccattacgccaatagatggcgctgtcgctgtgccggcggcagaagttgctcttctctcttccttcttga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7723815 |
tggtggtggtggttatacatcgaagctgactccattacgccaatagatggcgctgtcgctgtgccagcggcagaagttgctcttctctcttccttcttga |
7723716 |
T |
|
| Q |
112 |
atctgatcccacatgcattgcatagtgactgtaattcccattcaaattgaaactatcaaaagattgaaataaagttatatatttggaatgtatatattta |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | | || | |||||||| |
|
|
| T |
7723715 |
atctgatcccacatgcattgcataatgactgtaatt-ccattcaaattgaaactatcaaaagattgaaataaagttatata-tagttatat-tatattta |
7723619 |
T |
|
| Q |
212 |
gagtannnnnnnnacctttgggcctcgagggccgttcctccaaagcggtgtggaggtggtgtcacagtttgcac |
285 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723618 |
gagtattttttttacctttgggcctcgagggccgttcctccaaagcggtgtggaggtggtgtcacagtttgcac |
7723545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 90 - 156
Target Start/End: Original strand, 32956020 - 32956086
Alignment:
| Q |
90 |
gctcttctctcttccttcttgaatctgatcccacatgcattgcatagtgactgtaattcccattcaa |
156 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| ||||||||||||||||| |||| | |||||| |
|
|
| T |
32956020 |
gctcttctctcttccttcttgtatctaatcccacaagcattgcatagtgactgcaatttcaattcaa |
32956086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University