View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8760_low_17 (Length: 228)
Name: NF8760_low_17
Description: NF8760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8760_low_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 61 - 228
Target Start/End: Original strand, 15148200 - 15148368
Alignment:
| Q |
61 |
tgattattataatttgcagtcttagacaattactttgttgaaagatagagatgttcctagaaatataagactagacaaaggtcttgaaacatgagaatag |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15148200 |
tgattattataatttgcagtcttagacaattactttgttgaaagataaagatgttcctagaaatataagactagacaaaggtcttgaaacatgagaatag |
15148299 |
T |
 |
| Q |
161 |
ctt-aaggcttttgggatgtaatgaataatatggtgcaatcggtcttactcttaccaacatagaaacca |
228 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15148300 |
cttaaaggcttttgggatgtaatgaataatatggtgcaatcggtcttactcttaccaacatagaaacca |
15148368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University