View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8761_high_18 (Length: 257)
Name: NF8761_high_18
Description: NF8761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8761_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 34572894 - 34572655
Alignment:
| Q |
1 |
ggaactgcaagtaatattattacaagtgagtggcaagtgaggtgtgaggagtagaaagaaagtaaaaagtgtttt-agtcccacattgctagcaaaggaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||| |
|
|
| T |
34572894 |
ggaactgcaagtaatattattacaagtgagtggcaagtgaggtgtgaggagtagaaagaaagtaaaaagtgtttttagtcccacattgccaccaaaggaa |
34572795 |
T |
|
| Q |
100 |
ctaacatatgtgaacttgttctacattaacatcacatgtgaactgaaactttaacaaagtgaatgtgcatgaggcattttattgttatcccaatgtcact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34572794 |
ttaacatatgtgaacttgttctacattaacatcacatgtgaactgaaactttaacaaagtgaatatgcatgaggcattttattgttgtcccaatgtcact |
34572695 |
T |
|
| Q |
200 |
gtttctgtacatcgctgacatgtcaattttgtgttgttgg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572694 |
gtttctgtacatcgctgacatgtcaattttgtgttgttgg |
34572655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 47
Target Start/End: Complemental strand, 34583358 - 34583329
Alignment:
| Q |
18 |
tattacaagtgagtggcaagtgaggtgtga |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34583358 |
tattacaagtgagtggcaagtgaggtgtga |
34583329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University