View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8761_high_2 (Length: 599)
Name: NF8761_high_2
Description: NF8761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8761_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 8e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 8e-75
Query Start/End: Original strand, 18 - 164
Target Start/End: Complemental strand, 53951558 - 53951412
Alignment:
| Q |
18 |
aattagatatacctctggatccaacggttagggatgagttgttattccaaacaggtgcaccagaatttgtagtccagaaaggagaattgtaagcgctgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53951558 |
aattagatatacctctggatccaacggttagggatgagttgttattccaaacaggtgcgccagaatttgtagtccagaaaggagaattgtaagcgctgga |
53951459 |
T |
 |
| Q |
118 |
cggacggtgctgtaacgaaattaacaaaattaacacttgaacgagac |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53951458 |
cggacggtgctgtaacgaaattaacaaaattaacacttgaacgagac |
53951412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 277 - 425
Target Start/End: Complemental strand, 53951299 - 53951151
Alignment:
| Q |
277 |
tattgttgtataccttgtatggatccatggttggtaatggtagagagaaaagatgaggacggtggagaagaagaaatggatagagattaagaaattgaca |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53951299 |
tattgttgtataccttgtatggatccatggttggtaatggtagagagaaaggatgaggacggtggagaagaagaaatggatagagattaagaaattgaca |
53951200 |
T |
 |
| Q |
377 |
aaacaatttcctgcgataatcgcgagtcttatcgcctcatatataaata |
425 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53951199 |
aaacaatttcgtgcgataatcgcgagtcttatcgcctcatatataaata |
53951151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University