View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8761_low_17 (Length: 323)
Name: NF8761_low_17
Description: NF8761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8761_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 7450347 - 7450543
Alignment:
| Q |
18 |
agagatgtgggtcaaggaaattgaaaatgacatttcttagaaggttgttgaggttgaggttgtaaggaaagacatcggggaggtggagaagattccgaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
7450347 |
agagatgtgggtcaaggaaattgaaaatgacatttcttagaacattgttgaggctgaggttgtaaggaaagacattggggaggtggagcagattccgaca |
7450446 |
T |
|
| Q |
118 |
tcgagtgtgaggtaggctctctcaggtcgagttacacttcttgaatatgaacgtgataannnnnnnccttgaaggttggcctcgaaatgggaaaatc |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7450447 |
tcgagtgtgaggtaggctctctcaggttgagttacacttcttgaatatcaacgtgataatttttttccttgaaggttggcctcgaaatgggaaaatc |
7450543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 7458489 - 7458685
Alignment:
| Q |
18 |
agagatgtgggtcaaggaaattgaaaatgacatttcttagaaggttgttgaggttgaggttgtaaggaaagacatcggggaggtggagaagattccgaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
7458489 |
agagatgtgggtcaaggaaattgaaaatgacatttcttagaacattgttgaggctgaggttgtaaggaaagacattggggaggtggagcagattccgaca |
7458588 |
T |
|
| Q |
118 |
tcgagtgtgaggtaggctctctcaggtcgagttacacttcttgaatatgaacgtgataannnnnnnccttgaaggttggcctcgaaatgggaaaatc |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7458589 |
tcgagtgtgaggtaggctctctcaggttgagttacacttcttgaatatcaacgtgataatttttttccttgaaggttggcctcgaaatgggaaaatc |
7458685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 209 - 310
Target Start/End: Original strand, 7459098 - 7459199
Alignment:
| Q |
209 |
aaaatcctctttgccatccgagaaggcagagctcgaggatgcaatggacaaggtaggtggcgaatccttttggaatatttcttgatggatgttggttcat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7459098 |
aaaatcctctttgccatccgagaaggcagagctcgaggatgcaatggacaaggtaggtggcgaatccttttggaatatttcttgatggatgttggttcat |
7459197 |
T |
|
| Q |
309 |
ct |
310 |
Q |
| |
|
|| |
|
|
| T |
7459198 |
ct |
7459199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University