View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8761_low_3 (Length: 602)
Name: NF8761_low_3
Description: NF8761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8761_low_3 |
 | |
|
| [»] scaffold0179 (5 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 212; Significance: 1e-116; HSPs: 5)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 275
Target Start/End: Original strand, 1992 - 2251
Alignment:
| Q |
17 |
acatcaactgcttccaatttctctctaaaccttggcagcaacataagaaaaaatgaattatgctgtatatactcaagaaaaacttacagactagttgata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1992 |
acatcaactgcttccaatttctctctaaaccttggcagcaacataagaaaaaatgaattatgctgtatatactcaagaaaaacttacagactagttgata |
2091 |
T |
|
| Q |
117 |
accatgttgtatatactcatcacaaccctctagtttctctgtaacttaatggccgcaag-nnnnnnnntggagagtttttattgtctgtgaggttcactt |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
2092 |
accaagttgtatatactcatcacaaccctctagtttctctgtaacttaatggccgcaagaaaaaaaaatggacagtttttattgtctgtgaggttcactt |
2191 |
T |
|
| Q |
216 |
tcattgctggggtagcaattatgctgcagaagctacagttattagcccctaaaccaaatt |
275 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2192 |
tcattgttggggtagcaattatgctgcagaaggtacagttattagcccctaaaccaaatt |
2251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 285 - 385
Target Start/End: Original strand, 2297 - 2397
Alignment:
| Q |
285 |
gttatttaggtaggggagggtccaggtgagaggcaataaaacagtggttagtctctctggttattctctcctgaactggttagcagttaaggttcccggt |
384 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2297 |
gttatttaggtaggggagggtctaggtgagagccattaaaaaagtggttagtctctctggttattctctcctgaactgattagcagttaaggttcccggt |
2396 |
T |
|
| Q |
385 |
t |
385 |
Q |
| |
|
| |
|
|
| T |
2397 |
t |
2397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #3
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 459 - 514
Target Start/End: Original strand, 2396 - 2451
Alignment:
| Q |
459 |
ttaacaggggaggttacttgcgaaaggtggaccaacatgatttcaaaggacatttt |
514 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
2396 |
ttaacaggggaggttacttgcaaaaggtggaccaacatgttttcaaaggacatttt |
2451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 543 - 584
Target Start/End: Original strand, 2456 - 2497
Alignment:
| Q |
543 |
tagaatataagctagcaggatttcatgtttttcgcttatggt |
584 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2456 |
tagaatataagctagcaggatttcatgtttttcgcttatggt |
2497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 511 - 546
Target Start/End: Original strand, 2484 - 2519
Alignment:
| Q |
511 |
ttttcgcttatggttctgttgtgatcttgtgataga |
546 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2484 |
ttttcgcttatggttctgttgtgattttgtgataga |
2519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University