View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8762_high_12 (Length: 245)
Name: NF8762_high_12
Description: NF8762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8762_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 38568376 - 38568144
Alignment:
| Q |
1 |
atttgaaaaatagaataattgaatgtaatcgcatattagtgtcgtttggacaccggacacaaatttaatgtgaagtgtctactacatagctttgaattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568376 |
atttgaaaaatagaataattgaatgtaatcgcatattagtgtcgtttggacaccggacacaaatttaatgtgaagtgtctactacatagctttgaattta |
38568277 |
T |
 |
| Q |
101 |
tttttctgaatgaaggtttcattttatgtttgaaaaaacaggttgggaaatttctgcagctaatagcaacatttgttggcggttttgtgatagcatttag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568276 |
tttttctgaatgaaggtttcattttatgtttgaaaaaacaggttgggaaatttctgcagctaatagcaacatttgttggcggttttgtgatagcatttac |
38568177 |
T |
 |
| Q |
201 |
cagaggatggcttcttactgttgtattgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38568176 |
cagaggatggcttcttactgttgtattgatgtc |
38568144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 111 - 233
Target Start/End: Complemental strand, 38527125 - 38527003
Alignment:
| Q |
111 |
tgaaggtttcattttatgtttgaaaaaacaggttgggaaatttctgcagctaatagcaacatttgttggcggttttgtgatagcatttagcagaggatgg |
210 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||| | ||| ||| |
|
|
| T |
38527125 |
tgaaggtttaattttgtgtttgaaaaaacaggttgggaagtttctgcagctaatagcaacatttattgggggttttgtgatagcatttacaaaagggtgg |
38527026 |
T |
 |
| Q |
211 |
cttcttactgttgtattgatgtc |
233 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
38527025 |
cttcttactgttgttatgatgtc |
38527003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University