View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8762_low_11 (Length: 342)
Name: NF8762_low_11
Description: NF8762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8762_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 19 - 204
Target Start/End: Original strand, 25947998 - 25948183
Alignment:
| Q |
19 |
tttgcgtgtcgccactgttaattactttatgttgattaatattgatctttttaggttctatttttccttcacgagctttaaaacaagggagtatgttgtc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25947998 |
tttgcgtgtcgccactgttaattactttatgttgattaatattgatctttttaggttctatttttccttcacgagctttaaaacaagggagtatgttgtt |
25948097 |
T |
|
| Q |
119 |
tctaggggtgtcagcggggcagaggcggggagtacttcgcagaaagatgaacttgagtaaatcatataataattaagacattattg |
204 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25948098 |
tctaggggtgtcaatggggcagaggcggggagtacttcgcagaaagatgaacttgagtaaatcatataataattaagacattattg |
25948183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 25948260 - 25948312
Alignment:
| Q |
281 |
caattataaaatgtattttagtgaattgcttgggcgcaggtctgcatctctgc |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25948260 |
caattataaaatgtattttagtgaattgcttgggagcaggtctgcatctctgc |
25948312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University