View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8762_low_13 (Length: 271)
Name: NF8762_low_13
Description: NF8762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8762_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 45123082 - 45122841
Alignment:
| Q |
1 |
gattctgagggatcatcacctctcactgttacttcccgggtatgtatgtatgtatg----ctactttctatttattttcaattttcttcattcattcaat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45123082 |
gattctgagggatcatcacctctcactgttacttcccgggtatgtatgtatgtatgtatgctactttctatttattttcaattttcttcattcattcaat |
45122983 |
T |
|
| Q |
97 |
tcaaaacttcnnnnnnnnnnnnnnatgatttcaggttttgtgtatgttgggagacatcactgctggacctgctattatgttcacacaatggcttcaatca |
196 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122982 |
tcaaaactt--------tttttttatgatttcaggttttgtgtatgttgggagacatcactgctggacctgctattatgttcacacaatggcttcaatca |
45122891 |
T |
|
| Q |
197 |
gttcgtaaacgaacttccaatcatcgttcctctggatttcctcgctcttc |
246 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
45122890 |
gttcgtaaacgaacttccagtcatcgctcctctggatttcctcgctcttc |
45122841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 175 - 240
Target Start/End: Complemental strand, 40259109 - 40259044
Alignment:
| Q |
175 |
gttcacacaatggcttcaatcagttcgtaaacgaacttccaatcatcgttcctctggatttcctcg |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| || |||| |||||||| || ||||| |
|
|
| T |
40259109 |
gttcacacaatggcttcaattggttcgtaaacgcacttcaaagtatcgatcctctggcttccctcg |
40259044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University