View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8762_low_16 (Length: 243)
Name: NF8762_low_16
Description: NF8762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8762_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 40 - 226
Target Start/End: Original strand, 969725 - 969911
Alignment:
| Q |
40 |
aaacaaaaattgtcaaaattacaaccagcctctgaattatcaagaacagcactacctggttgcaatgcctctgagtgtttgacgtagttttgtgttgtct |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
969725 |
aaacaaaaattgtcaaaattacaaccagcctctaaattatcaagaacagcactacctggttgcagtgcctctgagtgtttgacgtagttttgtgttgtct |
969824 |
T |
|
| Q |
140 |
tctcacgattggttggattttaagcttgatagaccgttggtcttgggagctttgattcattgctcaatgctcatgaccttcggtttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
969825 |
tctcacgattggttggattttaagcttgatagaccgttggtcttgggagctttgattcattgctcagtgctcacgaccttcggtttt |
969911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University