View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8762_low_8 (Length: 419)
Name: NF8762_low_8
Description: NF8762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8762_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 123 - 404
Target Start/End: Complemental strand, 79088 - 78811
Alignment:
| Q |
123 |
gatcatcaatacacaaatcaaaacgcgcacttccataattgatttgtgctgcgttttggcatcattgaggaagaagatgcatctcaaccacaacctctcg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
79088 |
gatcatcaatacacaaatcaaaacgcgcacttccataattgatttgtgctgcgttttggcatcattgaggaagaagatgcatatcaaccacaacctctcg |
78989 |
T |
 |
| Q |
223 |
tggttgtggattattgttttgatctcaaccgcctcagtacaatgcaaaacctcttcccaagatggttggtgatgattgattgattgatgaatgcttttct |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
78988 |
tggttgtggattattgttttgatctcaaccgcctcagtacaatgcaaaacctcctcccaagatggttggtgatgattgat----tgatgaatgcttttct |
78893 |
T |
 |
| Q |
323 |
acctttttcctcttcatcttatcatttattttcatgtttgttaatgttttgtttcaaatcatatcaacagtttcagccctta |
404 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
78892 |
acctttttcctcctcatcttatcatttattttcatgtttgttaatgttttgtttcaaatcatatcaacagtttcagccctta |
78811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University