View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8763_low_11 (Length: 225)
Name: NF8763_low_11
Description: NF8763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8763_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 203
Target Start/End: Original strand, 29433228 - 29433424
Alignment:
| Q |
7 |
attatatcttctatggacaggaaaacatttatatcgtatatgtgcttgaatatgtttttgatctcttgaaaatacataagttctcaatttgttgtgcagt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29433228 |
attatatcttctatggacaggaaaacatttatatcgtatatgtgcttaaatatgtttttgatctcttgaaaatacataagttctcaatttgttgtgcagt |
29433327 |
T |
|
| Q |
107 |
tttttgctgaagccggtttcccttgtccgcgtaaaagaaatccttctgatcacttcctaagatgtatcaattctgatttcgatgttgtaacggctac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29433328 |
tttttgctgaagccggtttcccttgtccgcgtaaaagaaatccttctgatcacttcctaagatgtatcaattctgatttcgatgttgtaacggctac |
29433424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 93 - 203
Target Start/End: Original strand, 29466342 - 29466452
Alignment:
| Q |
93 |
atttgttgtgcagttttttgctgaagccggtttcccttgtccgcgtaaaagaaatccttctgatcacttcctaagatgtatcaattctgatttcgatgtt |
192 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||| |
|
|
| T |
29466342 |
atttcttgtgcagttttttgctgaagctggtttcccttgtccacgtaaaagaaatccttctgatcacttcctaagatgcatcaattctgacttcgacgtt |
29466441 |
T |
|
| Q |
193 |
gtaacggctac |
203 |
Q |
| |
|
||||||||||| |
|
|
| T |
29466442 |
gtaacggctac |
29466452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University