View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8763_low_12 (Length: 219)
Name: NF8763_low_12
Description: NF8763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8763_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 9 - 200
Target Start/End: Complemental strand, 25549925 - 25549734
Alignment:
| Q |
9 |
agaagcagagatacacgttgatattaatcgcgaataatttttggcatctgtgagaaatatcactgaggtaaatgtttcagttatacttatgcgtaaattt |
108 |
Q |
| |
|
|||| |||| ||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
25549925 |
agaaacagaaatacacgttgatattaaccgcgaagaatttttggcatctgtgagaaatatcactaaggtaaatgtttcaattatacttatacgtaaattt |
25549826 |
T |
 |
| Q |
109 |
taatggtgtttttccctagctgcaacctatttgggagaattttttgctgcatttttaactaaatttttcaattgattacgacagctaagtta |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25549825 |
taatggtgtttttccctagctgcaagctatttgggagaattttttgctgcatttttaactaaatttttcaattgattacgacagctaagtta |
25549734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University