View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8764_low_4 (Length: 350)
Name: NF8764_low_4
Description: NF8764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8764_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 17 - 348
Target Start/End: Complemental strand, 37332598 - 37332266
Alignment:
| Q |
17 |
aaagtcattactgatatgatccatatgcgagaagagtcatcaccagaaaatccgccgatgataatatatgtcaccataatagaacctagatattcgtaca |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
37332598 |
aaagtcatcactgatatgatccatatgcgagaagagtcatcaccagaaaatccgccgatgataatatatgtcaccataatagaacctagatatttgtgca |
37332499 |
T |
|
| Q |
117 |
ccaaagaccaagacttgactcgaaactagtgtgtcgaggcaaagtttgagaggccaatgtgcatgtgagatcattgtagacggtgatctccttgt-gtag |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37332498 |
ccaaagaccaagactagactcgaaactagtgtgtcgaggcaaagtttgagaggccaatgtgcatgtgagatcattgtagacggtgatctccttgtggtag |
37332399 |
T |
|
| Q |
216 |
gttggttttgagatggccgtagtggtctgattggttgatagaaaggtcgtcaaaattgacaacaacatacgattgtatgtggctaaaattgaatcgacga |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
37332398 |
gttggttttgagatggccgtagtggtctgattggttgatagaaaggtcgtcaaaattgacaacgacatacgattgtatgtggccaaaattgaatagacga |
37332299 |
T |
|
| Q |
316 |
aatttacacttatttgaatttggatcgtctgtg |
348 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
37332298 |
aatttacacttatttgaatttggatcgtttgtg |
37332266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University