View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8764_low_7 (Length: 245)
Name: NF8764_low_7
Description: NF8764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8764_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 66 - 225
Target Start/End: Original strand, 2392114 - 2392272
Alignment:
| Q |
66 |
accattcaattcccatgnnnnnnnnttgaatttggtcaatagataaataaattctagccaaaatttgttttaactagaatttgaactcgaattttttcgt |
165 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2392114 |
accattcaattcccatgaaaaaaaattgaatttggtcaatagataaataaattctagccaaaatttgttttaactagaatttgaactcgaa-tttttcgt |
2392212 |
T |
 |
| Q |
166 |
cttttatcgtagttcattaactaactatttaaagttaatcatgtgattaatattactagc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2392213 |
cttttatcgtagttcattaactaactatttaaagttaatcatgtgattaatattgctagc |
2392272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University