View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8765_low_9 (Length: 218)
Name: NF8765_low_9
Description: NF8765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8765_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 28931518 - 28931315
Alignment:
| Q |
1 |
cttgtgaaattgtgcaatcccacaattacgattgtgattttaataacattgagtcgtcaagtatataagcataacaactattctaacacttctatttaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28931518 |
cttgtgaaattgtgcaatcccacaattaagattgtgattttaataacattgagtcatcaagtatataagcataacaactattctaacacttctatttaca |
28931419 |
T |
 |
| Q |
101 |
actgattctaaatataagtattcccaattagatatgatattagtgcagtagtttgttattaatttacatatatgataaaaatgtaaaattcatacttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28931418 |
actgattctaaatataagtattcccaattagatatgatattagtgcagtagtttgttattaatttacatatatgataaaaatgtaaaattcatacttttg |
28931319 |
T |
 |
| Q |
201 |
tacc |
204 |
Q |
| |
|
|||| |
|
|
| T |
28931318 |
tacc |
28931315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 198
Target Start/End: Complemental strand, 3591449 - 3591420
Alignment:
| Q |
169 |
tatatgataaaaatgtaaaattcatacttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3591449 |
tatatgataaaaatgtaaaattcatacttt |
3591420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University