View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8766_high_6 (Length: 320)
Name: NF8766_high_6
Description: NF8766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8766_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 2 - 276
Target Start/End: Complemental strand, 40986817 - 40986543
Alignment:
| Q |
2 |
tatgaacatagatagagttggatgcagggaaggctcttgcttgcagcctccaccccatgtcgttcctagttttaggttttaaaatttaaatgcatcaatt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40986817 |
tatgaacatagatagagttggatgcagggaaggctcttgcttgcagcctccaccccatgtcgttcctagttttaggttttaaaatttaaatgcatcaatt |
40986718 |
T |
 |
| Q |
102 |
gtttaaggtgcatgttttgtaacgcagggcggtgggtctaaaagtttggatgctgtttgtgtatcacagttgtgggatctatgtttgtattgtggtaata |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40986717 |
gtttaaggtgcatgttttgtaacgcagggcggtgggtctaaaagtttggatgctgtttgtgtatcacggttgtgggatctatgtttgtattgtggtaata |
40986618 |
T |
 |
| Q |
202 |
atggatagtgggtgaaagctttaatgctttgaagtgtttttggttaactaacctaaggtttattttgttttttgt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40986617 |
atggatagtgggtgaaagctttaatgctttgaagtgtttttggttaactaacctaaggtttattttgttttttgt |
40986543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University