View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8766_low_13 (Length: 211)
Name: NF8766_low_13
Description: NF8766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8766_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 14 - 197
Target Start/End: Complemental strand, 31185698 - 31185515
Alignment:
| Q |
14 |
ttattctgtattttccgttagaacattagaggtttgggcatagaagggttacctcttctctgaggagcttatctgttggattttaagaggttttcttttg |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31185698 |
ttattctgcattttccgttagaacattagaggtttgggcatataagggttacctcttctctgaggagcttatctgttggattttaagaggttttcttttg |
31185599 |
T |
|
| Q |
114 |
taatatgagctgctagactttatgaggacatatcgaatttgggtggactgttaggctgaatgtttctttgaggaccatgaattt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31185598 |
taatatgagctgctagactttatgaggacatatcgaatttgggtggactgttaggctgaatgtttctttgaggaccatgaattt |
31185515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 14 - 197
Target Start/End: Complemental strand, 31007930 - 31007745
Alignment:
| Q |
14 |
ttattctgtattttccgttagaacattagaggtttgggcatagaaggg-ttacctcttctctgaggagcttatctgttgg-attttaagaggttttcttt |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| | |||||| ||||| ||||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
31007930 |
ttattttgtattttccgttagaacattagaggtttgggcatagaaagaattaccttttctcagaggagcttatatgttgggattttaaaaggttttcttt |
31007831 |
T |
|
| Q |
112 |
tgtaatatgagctgctagactttatgaggacatatcgaatttgggtggactgttaggctgaatgtttctttgaggaccatgaattt |
197 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||| ||| ||| |||||| ||||||||||| | ||||||||| |
|
|
| T |
31007830 |
tgtaatacgagctgctagactttatgaggacatattcaatttgggttgaccgtttggctgagagtttctttgagtagcatgaattt |
31007745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University