View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8766_low_9 (Length: 290)
Name: NF8766_low_9
Description: NF8766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8766_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 18 - 280
Target Start/End: Complemental strand, 25490559 - 25490297
Alignment:
| Q |
18 |
ctatctttctattagggtacacatcaatgttgatttcaacatatctaagccttttcatgtacaaaaatttcctaacctctttagtttctcggcatcctag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25490559 |
ctatctttctattagggtacacatcaatgttgatttcaacatatctaagccttttcatgtacaaaaatttcctaacctctttagtttctcggcatcctag |
25490460 |
T |
|
| Q |
118 |
tctcgtgtatagtatgattcttcctttcatgactatgggttgcagaggactttcagttattggttcctcccccttatcagttttattttctgcacctact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25490459 |
tctcgtgtatagtatgattcttcctttcatgactatgggttgcagaggactttcagttattggttcctcccccttatcagttttattttctgcacctact |
25490360 |
T |
|
| Q |
218 |
tctttggattcaccgtctcttgataaatctgaaacatcgttacctttattatcagaattatct |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25490359 |
tctttggattcaccgtctcttgataaatctgaaacatcgttacctttattatcagaattatct |
25490297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University