View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8767_low_1 (Length: 472)
Name: NF8767_low_1
Description: NF8767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8767_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 3e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 259 - 437
Target Start/End: Complemental strand, 54880664 - 54880480
Alignment:
| Q |
259 |
agatgggaaagtaaaagaaaggggacaaaagaattatgggcgaattggcattagggtccagaaacatcagctccactaggctcagcctcagcggtagtat |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54880664 |
agatgggaaagtaaaagaaaggggacaaaagaattatgggcgaattggcattagggtccagaaacatcagctccactaggctcagcctcagcggtagtat |
54880565 |
T |
|
| Q |
359 |
ttagtgtctcttctgactttgagagagtcacttaataactcatatcatat------gaatgaatcctatttcatatctatctctc |
437 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
54880564 |
ttagtgtctcttctgactttgagagagtcacttaataactcatatcatatgaatatgaatgaatcctatttcatatctatctctc |
54880480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 6 - 171
Target Start/End: Complemental strand, 54880962 - 54880797
Alignment:
| Q |
6 |
tttggtgttgaggtgaacaagagaaaaacgagtgtgtttggttgcgagcttgttggcacggtggatggtatgatcacatccatggcaaagagcagcttca |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54880962 |
tttggagttgaggtgaacaagagaaaaacgagtgtgtttggttgcgagcttgttggcacggtggatggtatgatcacatccatggcaaagagcagcttca |
54880863 |
T |
|
| Q |
106 |
tctgaaggacagaacatagtagcctcagctttctcacacacatcacattggatcttcatctcttgg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54880862 |
tctgaaggacagaacatagtagcctcagctttctcacacacatcacattggatcttcatctcttgg |
54880797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University