View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8767_low_10 (Length: 227)
Name: NF8767_low_10
Description: NF8767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8767_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 55336883 - 55336688
Alignment:
| Q |
16 |
tgaaatgcacaaaaacatctgcgaacagcgtcaaaattggaacaacctacttctaaacaacattaacatgattacactcactgctacaacattaactggt |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
55336883 |
tgaaatgcacaaaaacatcggcgaacagcgtcaaaattggaacaacctacttctaaacaacattaacatgattacactcactgctacaacattaacttgt |
55336784 |
T |
|
| Q |
116 |
attgcagccgcaactggtgctgatggtgcacaactgttggctctgaaactatcatccactcttctgttttcagcagcaacttgtatgttgcttatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55336783 |
attgcagccgcaactggtgctgatggtgcacaactgttggctctgaaactatcatccactcttctgttttcagcagcaactggtatgttgcttatc |
55336688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 55331444 - 55331269
Alignment:
| Q |
17 |
gaaatgcacaaaaacatctgcgaacagcgtcaaaattggaacaacctacttctaaacaacattaacatgattacactcactgctacaacattaactggta |
116 |
Q |
| |
|
||||||||||| ||| || || ||||||| || ||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| ||| |
|
|
| T |
55331444 |
gaaatgcacaacaacctcagccaacagcgacagaattggaacaacctacttctaaacaacatcaacatgatcacacttactgctacaacattaaccggtg |
55331345 |
T |
|
| Q |
117 |
ttgcagccgcaactggtgctgatggtgcacaactgttggctctgaaactatcatccactcttctgttttcagcagc |
192 |
Q |
| |
|
||| || |||| ||||||| ||| | | ||| |||||||| |||||||||||||| ||| | ||||| ||||| |
|
|
| T |
55331344 |
ttgtggctgcaagtggtgctattggcaccccacttttggctcttaaactatcatccacacttttattttctgcagc |
55331269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University