View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8768_low_12 (Length: 240)
Name: NF8768_low_12
Description: NF8768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8768_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 33496174 - 33496384
Alignment:
| Q |
1 |
agagatagtaggggtagcacccatggtttattaaaattcacacctgcaatccttaaaaaccgtatcatgaaatgaaacccctgatttgattatataatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
33496174 |
agagatagtaggggtagcacccatggtttattaaaattcacacctgcaatccttaaaaaccgtatcatgaac-----cccctgat-----tatataatgt |
33496263 |
T |
|
| Q |
101 |
tgcacctctgcatccaatgaaacactgccagcactgaacttgcatcttttcactctcattgtatgtgccgtgctactgctaaaactacacaatacgtgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33496264 |
tgcacctctgcatccaatgaaacactgccagcactgaacttgcatcttttcactctcattgtatgtgcagtgctactgctaaaactacacaatacgtgta |
33496363 |
T |
|
| Q |
201 |
gtgctattgctacaagtctat |
221 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
33496364 |
gtgctattgctacaagcctat |
33496384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University