View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8768_low_8 (Length: 279)
Name: NF8768_low_8
Description: NF8768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8768_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 267
Target Start/End: Original strand, 14333886 - 14334146
Alignment:
| Q |
19 |
acaaaaaccttaggatcagggctaaagctgctgtttctctatccaaatgtgtctccaaaatggtaaagtttgccactccatttgaattatgatatgatgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14333886 |
acaaaaaccttaggatcagggctaaagctgctgtttctctatccaaatgtgtctccaaaatggtaaagtttggtactccatttgaattatgatatgatgt |
14333985 |
T |
 |
| Q |
119 |
agtgttatttattt------------tgatacatggtctaggtagaaagttttatactgtcaacaaatcacaaccaattaacgatccgatggtgtatatg |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14333986 |
agtgttatttattttgagtttaattttgatacatggtctaggtagaaagttttatactgtcaacaaatcacaaccaattaacgatccgatggtgtatatg |
14334085 |
T |
 |
| Q |
207 |
aattaaatcaatttgttttattggtgtttttgggtttgtgtatgtttctaaagagtattat |
267 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14334086 |
aattatatcaatttgttttattggtgtttttgggtttatgtatgtttctaaagagtattat |
14334146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University