View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8769_high_4 (Length: 236)
Name: NF8769_high_4
Description: NF8769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8769_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10625659 - 10625437
Alignment:
| Q |
1 |
aagtaccattaagttgcatctttatgatgaacaatggaaggtacattgttcaaaaaataaaatcttcaactgaattttatcaagtgatgggtgaaacttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10625659 |
aagtaccattaagttgcatctttatgatgaacaatggaaggtacattgttcaaaaaataaaatcttcaactgaattttatcaagtgatgggtgaaacatg |
10625560 |
T |
|
| Q |
101 |
gtatcgtaagagatcaacagagctgagaacttaccacaaaaactatcaaatagaaacatggggaaagatattgaattgtttaagtccaaaaggtctaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
10625559 |
gtatcgtaagagatcaacagagctgagaacttaccacaaaaactatcaaatagaaacatggggaaagatattaaattgtttaagtccaaaaggactaaat |
10625460 |
T |
|
| Q |
201 |
gataataacgggaaggttccaaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10625459 |
gataataacgggaaggttccaaa |
10625437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University