View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8769_low_5 (Length: 257)

Name: NF8769_low_5
Description: NF8769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8769_low_5
NF8769_low_5
[»] chr2 (1 HSPs)
chr2 (1-246)||(36248427-36248672)
[»] chr7 (1 HSPs)
chr7 (192-246)||(7707913-7707967)
[»] chr6 (1 HSPs)
chr6 (73-231)||(12694658-12694815)


Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 36248427 - 36248672
Alignment:
1 aggtaagtgttacatcacatcatccaagattgcttacttcgataggatagagtgttttgtggtgnnnnnnnagtgtttttgtgggctgttactgtcggtt 100  Q
    |||||| ||||||||||||||||| || ||||||||||| |||||||||| |||||||||||||         |||||||| ||||||||||| ||||||    
36248427 aggtaaatgttacatcacatcatcaaatattgcttacttggataggatagggtgttttgtggtgtttttttgttgtttttgcgggctgttactctcggtt 36248526  T
101 cagggatgcttctgttttgcgcccaattttagtgtttttaagcataattctgtgcctgtagcagctgctgctggccgctgttttagctggcttgggtagt 200  Q
    ||||||||||| | ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||| |||    
36248527 cagggatgcttttattttgcgcccaattttagtgtttttaagcataattttgtgcatgtagcagctgctgctggccgctgtttcagctggcttgggcagt 36248626  T
201 aggtggttttgtggtgctgtctagttttggtcgtgtagtgatgtcc 246  Q
    |||||||||||||||||||||||||||||||||||||||| |||||    
36248627 aggtggttttgtggtgctgtctagttttggtcgtgtagtgttgtcc 36248672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 192 - 246
Target Start/End: Complemental strand, 7707967 - 7707913
Alignment:
192 ttgggtagtaggtggttttgtggtgctgtctagttttggtcgtgtagtgatgtcc 246  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||    
7707967 ttgggcagtaggtggttttatggtgctgtctagttttggtcgtgtagtgttgtcc 7707913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 73 - 231
Target Start/End: Original strand, 12694658 - 12694815
Alignment:
73 gtgtttttgtgggctgttactgtcggttcagggatgcttctgttttgcgcccaattttagtgtttttaagcataattctgtgcctgtagcagctgctgct 172  Q
    |||| |||| ||| |||||||||||| |  ||| |||| ||| ||||||| || |||  ||||||||| |||  |||||||| ||||||||||||||| |    
12694658 gtgtgtttgggggatgttactgtcggatgtgggctgctgctggtttgcgctcagtttgtgtgtttttaggcagtattctgtgtctgtagcagctgctgat 12694757  T
173 ggccgctgttttagctggcttgggtagtaggtggttt-tgtggtgctgtctagttttggt 231  Q
    |  |||||   |||||||| |||| |||||||| ||| | ||||||||||| ||||||||    
12694758 gagcgctg--ctagctggcctgggcagtaggtgttttatatggtgctgtcttgttttggt 12694815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University