View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8770_high_14 (Length: 278)
Name: NF8770_high_14
Description: NF8770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8770_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 39849683 - 39849928
Alignment:
| Q |
18 |
atgaggtgtgttgaaaaatatgcacttggccgtggaaatctaaaaatagcagtccaggagatggttccatttgttgaaccaaagttggcttttaccttcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39849683 |
atgaggtgtgttgaaaaatatgcacttggccgtggaaatctaaaaatagcagtccaggagatggttccatttgttgaaccaaagttggcttttaccttcc |
39849782 |
T |
 |
| Q |
118 |
attaaaattacccaaatgtgcaaacattgcagatccagaatggtcatcaatagcttgcacttctgctggaccattatgtacttctggatgagcaactggg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39849783 |
attaaaattacccaaatgtgcaaacattgcagatccagaatggtcatcaatagcttgcacttctgctggaccattatgtacttctggatgagcaactggg |
39849882 |
T |
 |
| Q |
218 |
gggtcatcgaaagtgtggagcgaacaaatgaaatatttactggttt |
263 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39849883 |
gggtcatcgaaagtgtggagggaacaaatgaaatatttactggttt |
39849928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 111 - 202
Target Start/End: Original strand, 13973104 - 13973195
Alignment:
| Q |
111 |
accttccattaaaattacccaaatgtgcaaacattgcagatccagaatggtcatcaatagcttgcacttctgctggaccattatgtacttct |
202 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||||||| |||||||||| ||||||||||||| ||||| || |||| ||||| ||||||| |
|
|
| T |
13973104 |
accttccattaagattactaaactgtgcaaacattgcagttccagaatggccatcaatagcttgaacttcagcaggactattatttacttct |
13973195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University