View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8770_high_20 (Length: 238)
Name: NF8770_high_20
Description: NF8770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8770_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 87 - 221
Target Start/End: Complemental strand, 4164365 - 4164231
Alignment:
| Q |
87 |
gttttatggtgaaccaccttatatctggtccaacgtaaactagtacttgataattaaaaattccaacaaaaattatagtctgacaccagtgatcaaagtt |
186 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
4164365 |
gttttacggtgaaccatcttatatctggtccaacgtaaattagtacttgataattaaaaattccaacaaaaattatagtccgacaccaacgatcaaagtt |
4164266 |
T |
|
| Q |
187 |
tatggtgatctttgtcgtaattttgagacgattgt |
221 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
4164265 |
tatggtgatctttgtcgtaattctgagacgattgt |
4164231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 4164451 - 4164411
Alignment:
| Q |
1 |
ctatgctatataaatttttggagacatttgtcatactatta |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4164451 |
ctatgctatataaatttttggagacatttgtcatactatta |
4164411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University