View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8770_high_20 (Length: 238)

Name: NF8770_high_20
Description: NF8770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8770_high_20
NF8770_high_20
[»] chr4 (2 HSPs)
chr4 (87-221)||(4164231-4164365)
chr4 (1-41)||(4164411-4164451)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 87 - 221
Target Start/End: Complemental strand, 4164365 - 4164231
Alignment:
87 gttttatggtgaaccaccttatatctggtccaacgtaaactagtacttgataattaaaaattccaacaaaaattatagtctgacaccagtgatcaaagtt 186  Q
    |||||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||  ||||||||||    
4164365 gttttacggtgaaccatcttatatctggtccaacgtaaattagtacttgataattaaaaattccaacaaaaattatagtccgacaccaacgatcaaagtt 4164266  T
187 tatggtgatctttgtcgtaattttgagacgattgt 221  Q
    |||||||||||||||||||||| ||||||||||||    
4164265 tatggtgatctttgtcgtaattctgagacgattgt 4164231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 4164451 - 4164411
Alignment:
1 ctatgctatataaatttttggagacatttgtcatactatta 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
4164451 ctatgctatataaatttttggagacatttgtcatactatta 4164411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University