View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8770_low_10 (Length: 342)
Name: NF8770_low_10
Description: NF8770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8770_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 44989609 - 44989749
Alignment:
| Q |
1 |
cattcaatcaaatacgattctacttttaaattaagtcacgttatggtttatgtcatagtcaagataaaagatacaagcaattatatcttatctaaatcta |
100 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
44989609 |
cattcaatcaaatacgattatccttttaaattaagtaacgttatggtttatgtcatagtcaagataaaagatagaagcaattatatcttatctaaatcaa |
44989708 |
T |
|
| Q |
101 |
cnnnnnnnatatcttataaattaagtcagtcatattgtttt |
141 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44989709 |
ctttttttatatcttataaattaagtcagtcatattgtttt |
44989749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 182 - 322
Target Start/End: Original strand, 44989747 - 44989871
Alignment:
| Q |
182 |
tttgctattcggtgagattgctctaggactttgtgtctttagggagtctcagttgggctcggctaggttttattttgatctggtatgcaactctgtctgt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| ||||| | |
|
|
| T |
44989747 |
tttgctattcggtgagattgctctaggactttgtgtctttagggagtctcagtta--------------ttatt--gatctggtatgcaactatgtctct |
44989830 |
T |
|
| Q |
282 |
ggtctatccaagaaacctcattatatgtctgtcattctctt |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44989831 |
ggtctatccaagaaacctcattatatgtctgtcattctctt |
44989871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University