View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8770_low_7 (Length: 373)
Name: NF8770_low_7
Description: NF8770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8770_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 44576228 - 44575875
Alignment:
| Q |
1 |
gataatgatagacctaattgtaaacatccaaaagattggcaactaggagttctatttacaggtcttggactattatccattggagctggtggaattaggc |
100 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44576228 |
gataatgataggcctaattgtcaacatccaaaagattggcaactaggagttctatttacaggtcttggactattatccattggtgctggtggaattaggc |
44576129 |
T |
 |
| Q |
101 |
cttgcaacattgcatttggtgctgaccaatttgacaccaacacagcaaagggaaggggacaattagagagcttctttaattggtggtatttcactttcac |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44576128 |
cttgtaacattgcatttggtgctgaccaatttgacaccaacacagcaaagggaaggggacaattagagagcttctttaattggtggtatttcactttcac |
44576029 |
T |
 |
| Q |
201 |
cattgcacttgttatagtgctcactggtgttgtctatattcaaactaatgtaagctggactttaggatttgcaattccgacggtttgtcttgctttctcg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44576028 |
cattgcacttgttatagtgctcactggtgttgtctatattcaaactaatgtaagctggactttaggatttgcaattccgacggtttgtcttgctttctca |
44575929 |
T |
 |
| Q |
301 |
ataatcatctttctatttggtcgcggcacttacatttacaaaaaacctcaaggg |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575928 |
ataatcatctttctatttggtcgcggcacttacatttacaaaaaacctcaaggg |
44575875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University