View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8771_high_17 (Length: 238)
Name: NF8771_high_17
Description: NF8771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8771_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 32956431 - 32956212
Alignment:
| Q |
15 |
aacaatattggtagtaactctaacaatgattctcttcttgctcgtcgatgtgctagctgtgactccacttctacacccctttggaggaatggtcctcgtg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32956431 |
aacaatattggtagtaactctaacaatgattctcttcttgctcgtcgttgtgctagctgtgactccacttctacacccctttggaggaatggtcctcgtg |
32956332 |
T |
 |
| Q |
115 |
gccctaaggtaaaaatacattaccaataccacctttgtgtctatgttcaaaatatatgagccaagacctcgtagtagactataaatgttcggcaaaaatc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32956331 |
gccctaaggtaaaaatacattaccaataccatctttgtgtctatgttcaaaatatatgagccgagacctcgtagtagactataaatgttcggcaaaaatc |
32956232 |
T |
 |
| Q |
215 |
atttatagcttactaggtct |
234 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
32956231 |
atttataacttactaggtct |
32956212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 36 - 129
Target Start/End: Original strand, 7723517 - 7723610
Alignment:
| Q |
36 |
aacaatgattctcttcttgctcgtcgatgtgctagctgtgactccacttctacacccctttggaggaatggtcctcgtggccctaaggtaaaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | ||||||| |||| || ||||| ||||||||||| || ||||| ||||| |||||||||| |
|
|
| T |
7723517 |
aacaatgattctcttcttgctcgtagatgtgcaaactgtgacaccacctccacaccgctttggaggaacggccctcgaggcccaaaggtaaaaa |
7723610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University