View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8771_low_24 (Length: 235)
Name: NF8771_low_24
Description: NF8771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8771_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 10576162 - 10575962
Alignment:
| Q |
20 |
caggagatgctaatgtttttctatccttgtgaataaatgcaaaatttatgatgaagatagcatggcaagagctacccactataaaaatgtgggtcttcgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| | |
|
|
| T |
10576162 |
caggagatgctaatgtttttctatccttgtgaataaatgcaaaatttatgatgaagatagcatggcaagagctactcactataagaatgtgggtcttctt |
10576063 |
T |
 |
| Q |
120 |
taggacaagacgttctgattaacataatttatggtgattatgttaatcacagatgcaatattcaacacagaacttaatagcttacaatagttcatgatgt |
219 |
Q |
| |
|
| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10576062 |
tgggacaagaagttctgattaacataatttatggtgattatgttaatcacagatgcaatattgaacacagaacttaatagcgtacaatagttcatgatgt |
10575963 |
T |
 |
| Q |
220 |
c |
220 |
Q |
| |
|
| |
|
|
| T |
10575962 |
c |
10575962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University