View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8771_low_26 (Length: 228)
Name: NF8771_low_26
Description: NF8771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8771_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 40193346 - 40193129
Alignment:
| Q |
1 |
tcatcctcttcttcctttctccttctctgtaagtaaacacggttcagaccttcccccaccatcgccggtcaccactccgtcgtcctaacccaccactgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
40193346 |
tcatcctcttcttcctttctccttctct----ataaacacggttcagaccttcccccaccatcgccggtcacaactccgccgtcctaacccaccactgaa |
40193251 |
T |
 |
| Q |
101 |
acgcacactcatcttctccaactcttccatcatcaccgcaccggtgagagtgaccagacaagagagaactccggcgaagagatggaaacaccaccatcaa |
200 |
Q |
| |
|
||| | ||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40193250 |
acgaaaactcatcttctccgactcttccatcatcac--caccggtgagagtgaccagacaagagagaactccggcgaagaggtggaaacaccaccatcac |
40193153 |
T |
 |
| Q |
201 |
cgtcctcatcaccaccatcttcca |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40193152 |
cgtcctcatcaccaccatcttcca |
40193129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University