View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8771_low_27 (Length: 227)
Name: NF8771_low_27
Description: NF8771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8771_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 26378665 - 26378875
Alignment:
| Q |
1 |
aaagatgactatgaatttaatatatatact-ctctccaattgcaatctaacagaatgctgtgaattttggcggagaaacatgatttagttgtggttccgt |
99 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26378665 |
aaagataactatgaatttacaatatatacttctctccaattgcaatctaacagaatgctgtgaattttggcggagaaacatgatttagttgtggttccgt |
26378764 |
T |
 |
| Q |
100 |
agatacaacgaaatcactcgtgtttcagctgtttgtccattttgttcaatgttagttcatttcggaccnnnnnnnnnnnntgttagtacgttgtattctg |
199 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26378765 |
agatacaacgaaaccactcgtgtttcagctgtttgtccattttgttcaatgttagttcatttcggaccaaaaaagaaaaatgttagtacgttgtattctg |
26378864 |
T |
 |
| Q |
200 |
aacaacttatt |
210 |
Q |
| |
|
||||||||||| |
|
|
| T |
26378865 |
aacaacttatt |
26378875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University