View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8771_low_28 (Length: 209)
Name: NF8771_low_28
Description: NF8771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8771_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 92 - 190
Target Start/End: Original strand, 18328066 - 18328164
Alignment:
| Q |
92 |
ttaagttttctacgtcgttctaattctatttatactaaaagaatatgtgttttttaagtgtactttaagagttaggaggataaggacagttcagtattt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18328066 |
ttaagttttctacgtcgttctaattctatttatagtaaaagaatatgagttttttaagtgtactttaagagttaggaggataaggacagttcagtattt |
18328164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 47
Target Start/End: Original strand, 18327981 - 18328010
Alignment:
| Q |
18 |
gttcttcgccatcgatcgtgcttttacctt |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18327981 |
gttcttcgccatcgatcgtgcttttacctt |
18328010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University